About   Help   FAQ
Zfp787em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp787em1(IMPC)J
Name: zinc finger protein 787; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6198582
Gene: Zfp787  Location: Chr7:6134490-6158996 bp, - strand  Genetic Position: Chr7, 3.55 cM
Alliance: Zfp787em1(IMPC)J page
IMPC: Zfp787 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTTGGACCAGAGATAGA and TGGTCTGCAGATCTAGAGAA, which resulted in a 2331 bp deletion beginning at Chromosome 7 position 6,131,115 bp and ending after 6,133,445 bp (GRCm38/mm10). This mutation deletes (ENSMUSE00000600779) (exon 3) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 43 amino acids later due to run on after exon 2. There is a 3 bp (CCA) endogenous retention at the deletion site that will not alter the results of the deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp787 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory