Myzap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myzap^em1(IMPC)J
• Name: myocardial zonula adherens protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200294
• Gene: Myzap Location: Chr9:71411629-71499642 bp, - strand Genetic Position: Chr9, 39.85 cM
• Alliance: Myzap^em1(IMPC)J page
• IMPC: Myzap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGACTTCGAGCAACTCAG, TCCCTGTTCACACATCCACT, GACTTCGAGCAACTCAGAGG and CTAGGCAGAGGATGAACACC, which resulted in a 166 bp deletion beginning at Chromosome 9 position 71,548,688 bp and ending after 71,548,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216161 (exon 9) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 311 and early truncation 19 amino acids later. In addition, there is a single bp A insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Myzap Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)