About   Help   FAQ
Myzapem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myzapem1(IMPC)J
Name: myocardial zonula adherens protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200294
Gene: Myzap  Location: Chr9:71411629-71499642 bp, - strand  Genetic Position: Chr9, 39.85 cM
Alliance: Myzapem1(IMPC)J page
IMPC: Myzap gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGACTTCGAGCAACTCAG, TCCCTGTTCACACATCCACT, GACTTCGAGCAACTCAGAGG and CTAGGCAGAGGATGAACACC, which resulted in a 166 bp deletion beginning at Chromosome 9 position 71,548,688 bp and ending after 71,548,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216161 (exon 9) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 311 and early truncation 19 amino acids later. In addition, there is a single bp A insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Myzap Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory