About   Help   FAQ
Asap3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Asap3em1(IMPC)J
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6200307
Gene: Asap3  Location: Chr4:135933676-135972527 bp, + strand  Genetic Position: Chr4, 68.34 cM
Alliance: Asap3em1(IMPC)J page
IMPC: Asap3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTGCCCAAAGGGTAGCAG and AGCTGTTGTGAAAGGACCAG, which resulted in a 282 bp deletion beginning at Chromosome 4 position 136,229,360 bp and ending after 136,229,641 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000497964(exon5) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 36 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Asap3 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory