Tesk1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tesk1^em1(IMPC)J
• Name: testis specific protein kinase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200319
• Gene: Tesk1 Location: Chr4:43442277-43448075 bp, + strand Genetic Position: Chr4, 23.04 cM, cytoband A5-C1
• Alliance: Tesk1^em1(IMPC)J page
• IMPC: Tesk1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGTGTGCCCGACAGGTTGGG, ACGGGTGGAACGATTAAAGA, CCAGCAAGCTGTCCAGCAAG and GTAGATACGTTAGGATGTCG, which resulted in a 899 bp deletion beginning at Chromosome 4 position 43,443,924 bp and ending after 43,444,822 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000179378, ENSMUSE00000384697 (exons 3 and 4) and 703 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 154 amino acids later. In addition, there is a 5 bp deletion (CCAAC) 175 bp before the deletion and a single bp [C] insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tesk1 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)