Fchsd2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fchsd2^em1(IMPC)J
• Name: FCH and double SH3 domains 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200336
• Gene: Fchsd2 Location: Chr7:100757836-100933613 bp, + strand Genetic Position: Chr7, 54.5 cM
• Alliance: Fchsd2^em1(IMPC)J page
• IMPC: Fchsd2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCCTACATAACAGCTTCCAG, AAGGCTAGATGGTCAGAAAT, CTAGTAAGATATATGGAGGG and GGAATTGCAATTTCTGTCTT, which resulted in a 288 bp deletion beginning at Chromosome 7 position 101,138,935 bp and ending after 101,139,222 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209356 (exon 3) and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fchsd2 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)