Mxra8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mxra8^em1(IMPC)J
• Name: matrix-remodelling associated 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6200400
• Gene: Mxra8 Location: Chr4:155924137-155928545 bp, + strand Genetic Position: Chr4, 87.58 cM, cytoband E2
• Alliance: Mxra8^em1(IMPC)J page
• IMPC: Mxra8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCAGGAGGCCCCAAG and GGTGGTATACAATGGTGGGA, which resulted in a 3613 bp deletion beginning at Chromosome 4 position 155,840,716 bp and ending after 155,844,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503248 through ENSMUSE00000228201 (exons 2 through 10) and 1575 bp of flanking intronic sequence including the splice acceptors and donors. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mxra8 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)