Cyp4f39^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp4f39^em1(IMPC)J
• Name: cytochrome P450, family 4, subfamily f, polypeptide 39; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6201606
• Gene: Cyp4f39 Location: Chr17:32671697-32712294 bp, + strand Genetic Position: Chr17, 17.59 cM
• Alliance: Cyp4f39^em1(IMPC)J page
• IMPC: Cyp4f39 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGAGTGGGGAGCAACTCA and GATAGAAGTTCACCAAACTG, which resulted in a 437 bp deletion beginning at Chromosome 17 position 32,470,647 bp and ending after 32,471,083 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511656 (exon 2) and 292 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cyp4f39 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)