About   Help   FAQ
Gm5547em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm5547em1(IMPC)J
Name: predicted gene 5547; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6202381
Gene: Gm5547  Location: Chr3:105722883-105724675 bp, + strand  Genetic Position: Chr3, 46.45 cM
Alliance: Gm5547em1(IMPC)J page
IMPC: Gm5547 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGACCACCCCATAAGAATT and GACTTGTCTTGCCATTAGTA, which resulted in a 2461 bp deletion beginning at Chromosome 3 position 105,815,236 bp and ending after 105,817,696 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001347726-ENSMUSE00001353780 (exons 1-4) and 1400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to create a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gm5547 Mutation:  2 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory