Avpr1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Avpr1a^em1(IMPC)J
• Name: arginine vasopressin receptor 1A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6208800
• Gene: Avpr1a Location: Chr10:122284404-122289357 bp, + strand Genetic Position: Chr10, 70.36 cM, cytoband D3
• Alliance: Avpr1a^em1(IMPC)J page
• IMPC: Avpr1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGGCTGGAGAAATTCCG and TAGAAGCTTAACTATTGAAT, which resulted in a 1550 bp deletion beginning at Chromosome 10 position 122,448,382 bp and ending after 122,449,931 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000100823 (exon 1) and 259 bp of flanking intronic sequence including the start of translation and splice donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Avpr1a Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)