Aamp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aamp^em1(IMPC)J
• Name: angio-associated migratory protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6208836
• Gene: Aamp Location: Chr1:74318999-74323897 bp, - strand Genetic Position: Chr1, 38.53 cM
• Alliance: Aamp^em1(IMPC)J page
• IMPC: Aamp gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCGCCTCCCATTCCACAA and CCAAACTTGCTGCAGCTCCA, which resulted in a 2087 bp deletion beginning at Chromosome 1 position 74,280,718 bp and ending after 74,282,804 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000156609-ENSMUSE00000156607 (exons 4-10) and 1252 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aamp Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)