Nup205^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nup205^em1(IMPC)J
• Name: nucleoporin 205; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6209645
• Synonyms: Nup205^-
• Gene: Nup205 Location: Chr6:35154551-35224534 bp, + strand Genetic Position: Chr6, 15.24 cM, cytoband B1
• Alliance: Nup205^em1(IMPC)J page
• IMPC: Nup205 gene page

Nup205^em1(IMPC)J/Nup205^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and are dead after 72hr in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by Microinjection Cas9 mRNA and 2 guide sequences AGGGGATATGAGGCAACACG and TGAAGCTAGAACCCCTATCT, which resulted in a 605 bp deletion beginning at Chromosome 6 position 35,186,016 bp and ending after 35,186,665 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000469332 (exon 3) and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nup205 Mutation: 103 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)