About   Help   FAQ
Ccnjem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccnjem1(IMPC)J
Name: cyclin J; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6214844
Gene: Ccnj  Location: Chr19:40819723-40837016 bp, + strand  Genetic Position: Chr19, 34.26 cM
Alliance: Ccnjem1(IMPC)J page
IMPC: Ccnj gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCGCAGCAATAAAGTTGAG and GTATCAATCTTGATGAGGTA, which resulted in a 560 bp deletion beginning at Chromosome 19 position 40,836,785 bp and ending after 40,837,344 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000386043 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccnj Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory