Cd4^em1Litt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cd4^em1Litt
• Name: CD4 antigen; endonuclease-mediated mutation 1, Dan R Littman
• MGI ID: MGI:6220669
• Synonyms: Cd4^E4mdelta, Rr95^em1Litt
• Gene: Cd4 Location: Chr6:124841655-124865184 bp, - strand Genetic Position: Chr6, 59.17 cM
• Alliance: Cd4^em1Litt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and ACTGACACACCCGCTCATCA), resulting in a deletion of the "maturity" enhancer E4m, a cis regulatory element in intron 1 of the Cd4 gene (chr6:124861963-124862659 (GRCm39)). (J:266228)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cd4 Mutation: 85 strains or lines available

References

• Original: J:266228 Issuree PD, et al., Stage-specific epigenetic regulation of CD4 expression by coordinated enhancer elements during T cell development. Nat Commun. 2018 Sep 5;9(1):3594
• All: 2 reference(s)