Cpsf4l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cpsf4l^em1(IMPC)J
• Name: cleavage and polyadenylation specific factor 4-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6220914
• Gene: Cpsf4l Location: Chr11:113588998-113600843 bp, - strand Genetic Position: Chr11, 79.17 cM
• Alliance: Cpsf4l^em1(IMPC)J page
• IMPC: Cpsf4l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTGAACGGAGAGAACACA and GTGTTTTGCAGAAAGTACCG, which resulted in a 3917 bp deletion beginning at Chromosome 11 position 113,699,772 bp and ending after 113,703,688 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108704-ENSMUSE00001266028 (exons 4-6) and 3577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 17 amino acids later. In addition, there is a 2 bp (TC) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cpsf4l Mutation: 64 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)