About   Help   FAQ
Tas2r103em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tas2r103em1(IMPC)J
Name: taste receptor, type 2, member 103; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6220917
Gene: Tas2r103  Location: Chr6:133013126-133014064 bp, - strand  Genetic Position: Chr6, 64.03 cM, cytoband F3
Alliance: Tas2r103em1(IMPC)J page
IMPC: Tas2r103 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACAAACATATAGAGAATTG and ATAAGTCTGGAGTTTATCAT, which resulted in an 861 bp bp deletion beginning at Chromosome 6 position 133,036,176 bp and ending after 133,037,036 bp (GRCm38/mm10). This mutation deletes 861 bp from ENSMUSE00000196281 (exon 1) and is predicted to cause a change of amino acid sequence after residue 22 back in frame for stop 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tas2r103 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory