Ccsap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccsap^em1(IMPC)J
• Name: centriole, cilia and spindle associated protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6220921
• Gene: Ccsap Location: Chr8:124567570-124586948 bp, - strand Genetic Position: Chr8, 72.22 cM, cytoband E2
• Alliance: Ccsap^em1(IMPC)J page
• IMPC: Ccsap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTGGACTTTGGTTAACTG and GATAGCGATGGTGACTCCTG, which resulted in a 707 bp deletion beginning at Chromosome 8 position 123,845,017 bp and ending after 123,845,723 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215358 (exon 2) and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccsap Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)