Fam53c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam53c^em1(IMPC)J
• Name: family with sequence similarity 53, member C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6241421
• Gene: Fam53c Location: Chr18:34891959-34906813 bp, + strand Genetic Position: Chr18, 18.72 cM
• Alliance: Fam53c^em1(IMPC)J page
• IMPC: Fam53c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGCATTTTTGAGGAGGAG and GTTAAAATTCAATACTGCCA, which resulted in a 1151 bp deletion beginning at Chromosome 18 position 34,767,928 bp and ending after 34,769,078 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000483922 (exon 4) and 366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam53c Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)