About   Help   FAQ
Insyn2aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Insyn2aem1(IMPC)J
Name: inhibitory synaptic factor 2A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6241425
Gene: Insyn2a  Location: Chr7:134483655-134540159 bp, - strand  Genetic Position: Chr7, 80.86 cM
Alliance: Insyn2aem1(IMPC)J page
IMPC: Insyn2a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Insyn2a Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory