Insyn2aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Insyn2aem1(IMPC)J |
Name: |
inhibitory synaptic factor 2A; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6241425 |
Gene: |
Insyn2a Location: Chr7:134483655-134540159 bp, - strand Genetic Position: Chr7, 80.86 cM
|
Alliance: |
Insyn2aem1(IMPC)J page
|
IMPC: |
Insyn2a gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|