Insyn2a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Insyn2a^em1(IMPC)J
• Name: inhibitory synaptic factor 2A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6241425
• Gene: Insyn2a Location: Chr7:134483655-134540159 bp, - strand Genetic Position: Chr7, 80.86 cM
• Alliance: Insyn2a^em1(IMPC)J page
• IMPC: Insyn2a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Insyn2a Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)