Dnajb4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnajb4^em1(IMPC)J
• Name: DnaJ heat shock protein family (Hsp40) member B4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6241427
• Gene: Dnajb4 Location: Chr3:151887217-151915720 bp, - strand Genetic Position: Chr3, 77.03 cM
• Alliance: Dnajb4^em1(IMPC)J page
• IMPC: Dnajb4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCCTAGAGAGTTACCATG and GCTAAAACGTTAACATAGGA, which resulted in an 837 bp deletion beginning at Chromosome 3 position 152,186,292 bp and ending after 152,187,134 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000175378(exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later. Also, after the deletion of 381 bp of sequence there is a 6 bp [GGTCTT] endogenous retention followed by an additional 405 deleted bp. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnajb4 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)