Del(13Naip1-Naip5)1Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(13Naip1-Naip5)1Vnce
• Name: deletion, Chr 13, Russell Vance 1
• MGI ID: MGI:6246513
• Gene: Del(13Naip1-Naip5)1Vnce Location: Chr13:100382831-100544278 bp Genetic Position: Chr13, Syntenic

Mutation origin

• Strain of Origin: B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intergenic deletion, Intragenic deletion
• Del(13Naip1-Naip5)1Vnce involves 4 genes/genome features (Naip5, Naip6, Naip3 ...) View all
• Mutation details: A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1. It also resulted in a 4 bp frameshift deletion in Naip2 gene Naip2^em2Vnce. (J:233320)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Del(13Naip1-Naip5)1Vnce Mutation: 1 strain or line available

References

• Original: J:233320 Rauch I, et al., NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivo. J Exp Med. 2016 May 2;213(5):657-65
• All: 5 reference(s)