Fblim1^em5(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fblim1^em5(IMPC)Tcp
• Name: filamin binding LIM protein 1; endonuclease-mediated mutation 5, The Centre for Phenogenomics
• MGI ID: MGI:6257420
• Gene: Fblim1 Location: Chr4:141303373-141333351 bp, - strand Genetic Position: Chr4, 74.64 cM, cytoband E1
• Alliance: Fblim1^em5(IMPC)Tcp page
• IMPC: Fblim1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele resulted from non-homologous end-joining repair and a 2-bp deletion from Chr4:141595338 to 141595339 in exon OTTMUSE00000117321. This mutation is predicted to cause a frameshift with amino acid changes after residue 40 and early truncation 51 amino acids later (p.A40Sfs*53). (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fblim1 Mutation: 82 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)