Gins3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gins3^em1(IMPC)Tcp
• Name: GINS complex subunit 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257451
• Gene: Gins3 Location: Chr8:96360187-96371687 bp, + strand Genetic Position: Chr8, 47.12 cM
• Alliance: Gins3^em1(IMPC)Tcp page
• IMPC: Gins3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1152 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCAGTGGAGTCGGGCGCTCT targeting the 5' side and ATGGGCGTCTCGACCCGCAC targeting the 3' side of a critical exon resulting in a 79-bp deletion Chr8: 95633624 to 95633702 (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gins3 Mutation: 9 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)