Col6a3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col6a3^em1(IMPC)Tcp
• Name: collagen, type VI, alpha 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257456
• Gene: Col6a3 Location: Chr1:90694582-90771710 bp, - strand Genetic Position: Chr1, 45.53 cM
• Alliance: Col6a3^em1(IMPC)Tcp page
• IMPC: Col6a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGCTACCCGGGTCCCATC, ACGCCCTGGACTACGCGCTT, GCTGCACGTTATCCTCGATG. This resulted in a 193-bp del Chr1: 90811522 to 90811714 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Col6a3 Mutation: 169 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)