Shld1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shld1^{em1(IMPC)Wtsi}
• Name: shieldin complex subunit 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6257464
• Gene: Shld1 Location: Chr2:132528871-132592975 bp, + strand Genetic Position: Chr2, 64.74 cM, cytoband F3
• Alliance: Shld1^{em1(IMPC)Wtsi} page
• IMPC: Shld1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, 4 guide sequences CCTCACAACGTCCTCCCAAGGCC, GCTTCATCATCACTACTAGCTGG, AGTTTCTTTGGAGTCGGACAAGG, CCAATTGATTGGCCTAAAGCAAT, and a non-contributing oligo, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Shld1 Mutation: 78 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)