Dym^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dym^em1(IMPC)Tcp
• Name: dymeclin; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257483
• Gene: Dym Location: Chr18:75151852-75420035 bp, + strand Genetic Position: Chr18, 50.97 cM, cytoband E2
• Alliance: Dym^em1(IMPC)Tcp page
• IMPC: Dym gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGTTGGAATCGTGCTGTC and CGTTCCCTGAGGTAGTCCTA targeting the 5' side and CAAGTGAGGAGAACTGCGTG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion of Chr18 from 75082183 to 75082187 and a 309-bp deletion of Chr18 from 75082260 to 75082568 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dym Mutation: 59 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)