Phf11c^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phf11c^em1(IMPC)Tcp
• Name: PHD finger protein 11C; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257484
• Gene: Phf11c Location: Chr14:59618282-59630961 bp, - strand Genetic Position: Chr14, 31.48 cM
• Alliance: Phf11c^em1(IMPC)Tcp page
• IMPC: Phf11c gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1078 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTCTAATTCCTATTTAGTG and GCAGGCCAGTGTTTTTGTCC targeting the 5' side and GCTCATTCCCACATAGTATG targeting the 3' side of a critical exon. This resulted in a 578-bp deletion Chr14:59388910 to 59389487;1-bp deletion at Chr14:59389528 (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Phf11c Mutation: 14 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)