Sspo^em8(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sspo^em8(IMPC)Tcp
• Name: SCO-spondin; endonuclease-mediated mutation 8, The Centre for Phenogenomics
• MGI ID: MGI:6257494
• Gene: Sspo Location: Chr6:48425163-48478184 bp, + strand Genetic Position: Chr6, 23.42 cM
• Alliance: Sspo^em8(IMPC)Tcp page
• IMPC: Sspo gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1063 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TAAGTGCTAGAAGGATCCTC and CAGGTCTCATGGTACTCATC targeting the 5' side and TTCCAATAACCAGCCCATTC and GCATGGCCAAACATTTACCC targeting the 3' side of a critical exon. This resulted in a 587-bp del Chr6: 48465273 to 48465859 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sspo Mutation: 224 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)