Ablim3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ablim3^em1(IMPC)Tcp
• Name: actin binding LIM protein family, member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257511
• Gene: Ablim3 Location: Chr18:61932463-62044895 bp, - strand Genetic Position: Chr18, 34.77 cM
• Alliance: Ablim3^em1(IMPC)Tcp page
• IMPC: Ablim3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1104 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of CAGGGGTGGATGCCTAAGCT and CATGAGTTGACGTGAGATGG targeting the 5' side and CGACACAGTTTGAAAACTAC and CTTATCTCATCATGCCCAGT targeting the 3' side of a critical exon resulting in a 578-bp del Chr18: 61856803 to 61857380 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ablim3 Mutation: 30 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)