Hibch^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hibch^em1(IMPC)Tcp
• Name: 3-hydroxyisobutyryl-Coenzyme A hydrolase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257527
• Gene: Hibch Location: Chr1:52884197-52960145 bp, + strand Genetic Position: Chr1, 26.99 cM
• Alliance: Hibch^em1(IMPC)Tcp page
• IMPC: Hibch gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1207 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTCATAAAACACTCGCAG and CCAAACATAAGAGACGATAA targeting the 5' side and ATGTTGGTGATACTAGGGGC and GAGTCTGCACACAGCGGGTT targeting the 3' side of a critical exon. This resulted in a 496-bp deletion Chr1:52862152 to 52862647 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hibch Mutation: 30 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)