Pdcd6ip^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdcd6ip^{em1(IMPC)Hmgu}
• Name: programmed cell death 6 interacting protein; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6257536
• Gene: Pdcd6ip Location: Chr9:113480812-113537327 bp, - strand Genetic Position: Chr9, 64.03 cM, cytoband F2
• Alliance: Pdcd6ip^{em1(IMPC)Hmgu} page
• IMPC: Pdcd6ip gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 RNA and 2 guide sequences CGCCGCTCGGGTACGTCTGCTGG, CTCGGCGCTCGGTCGCCCGCTGG, which resulted in a Indel. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdcd6ip Mutation: 42 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)