Nars1^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nars1^em1(IMPC)Bay
• Name: asparaginyl-tRNA synthetase 1; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257548
• Synonyms: Nars1^-
• Gene: Nars1 Location: Chr18:64632726-64649586 bp, - strand Genetic Position: Chr18, 37.47 cM
• Alliance: Nars1^em1(IMPC)Bay page
• IMPC: Nars1 gene page

Nars1^em1(IMPC)Bay/Nars1^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts do not hatch from the zona pellucida or form outgrowths in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences CTTGCGGCTCAGAATTCATATGG, CCGAGTTTAAGACTATCCCACCC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nars1 Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)