Septin11^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Septin11^em1(IMPC)Tcp
• Name: septin 11; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257588
• Gene: Septin11 Location: Chr5:93241296-93324306 bp, + strand Genetic Position: Chr5, 47.29 cM
• Alliance: Septin11^em1(IMPC)Tcp page
• IMPC: Septin11 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1079 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGCAAGGACTGAAGTCTCG and TACGCGTGATACTCTGCCCT targeting the 5' side and ACTTATGTGGTCAAACTTCA and TTTTCTGGGTGTTAGGCACG targeting the 3' side of a critical region. This resulted in a 4-del Chr5:93154667 to 93154670_insTAAGTGCCAGGGATTCTTA and 471_bp del Chr5:93154760 to 93155230 (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Septin11 Mutation: 57 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)