Etv6^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Etv6^{em1(IMPC)Rbrc}
• Name: ets variant 6; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6257614
• Gene: Etv6 Location: Chr6:134012663-134247121 bp, + strand Genetic Position: Chr6, 64.58 cM, cytoband G2
• Alliance: Etv6^{em1(IMPC)Rbrc} page
• IMPC: Etv6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 Protein and the guide sequence CCCATTGAGAGCAACAAGTTCGA, which resulted in a Indel. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Etv6 Mutation: 142 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)