4930447C04Rik^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4930447C04Rik^em1(IMPC)Bay
• Name: RIKEN cDNA 4930447C04 gene; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257636
• Gene: 4930447C04Rik Location: Chr12:72926967-72964742 bp, - strand Genetic Position: Chr12, 30.3 cM, cytoband C3
• Alliance: 4930447C04Rik^em1(IMPC)Bay page
• IMPC: 4930447C04Rik gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences GTTCTTTAAAGTCTGGCTGAGGG, CCTTGAATGGCGCACAGATCTAT, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any 4930447C04Rik Mutation: 29 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)