Serpine1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpine1^em1(IMPC)Tcp
• Name: serine (or cysteine) peptidase inhibitor, clade E, member 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257653
• Gene: Serpine1 Location: Chr5:137090358-137101122 bp, - strand Genetic Position: Chr5, 76.16 cM
• Alliance: Serpine1^em1(IMPC)Tcp page
• IMPC: Serpine1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1164 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTAGACGAGCTGACACGCC targeting the 5' side and CTGAGTTCACCACCCCCGAT targeting the 3' side of a critical exon. This resulted in a 863-bp deletion Chr5:137067011 to 137067873; p.(R185Pfs*50). (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serpine1 Mutation: 25 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)