Prkdc^em2(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkdc^em2(IMPC)Ics
• Name: protein kinase, DNA activated, catalytic polypeptide; endonuclease-mediated mutation 2, Mouse Clinical Institute
• MGI ID: MGI:6257656
• Gene: Prkdc Location: Chr16:15455730-15660099 bp, + strand Genetic Position: Chr16, 10.09 cM, cytoband B1
• Alliance: Prkdc^em2(IMPC)Ics page
• IMPC: Prkdc gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CCTCATGCTAGTTTTATTACTTG, ATTACTTGCAACCGTTTTAGAGG, CCATCCAGCAGTCACTTTCGTTT, CTCTTGATATTAAGGTAAGGAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prkdc Mutation: 418 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)