Zcwpw1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zcwpw1^em1(IMPC)Tcp
• Name: zinc finger, CW type with PWWP domain 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257662
• Synonyms: Zcwpw1^-
• Gene: Zcwpw1 Location: Chr5:137786060-137820883 bp, + strand Genetic Position: Chr5, 76.71 cM
• Alliance: Zcwpw1^em1(IMPC)Tcp page
• IMPC: Zcwpw1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1080 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCCCGGTTCTTCATCCAATT targeting the 5' side and GACTGCACTCACGGCCATCT targeting the 3' side of a critical exon. This resulted in a 1485-bp del Chr5:137799545 to 137801029. (GRCm38). (J:265051, J:296124)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zcwpw1 Mutation: 32 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)