Nhsl2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nhsl2^em1(IMPC)Tcp
• Name: NHS like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257670
• Gene: Nhsl2 Location: ChrX:100892991-101135661 bp, + strand Genetic Position: ChrX, 44.75 cM
• Alliance: Nhsl2^em1(IMPC)Tcp page
• IMPC: Nhsl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1180 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TAATGGTCCGCCTCCGCCTC targeting the 5' side and CTCAATGACCGTGGTGCCGG targeting the 3' side of a critical exon. This resulted in a 2323-bp ChrX:102076244 to 102078566; p.(R281Afs*39) resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nhsl2 Mutation: 12 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)