Polr3d^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3d^em1(IMPC)Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide D; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257695
• Gene: Polr3d Location: Chr14:70676197-70680887 bp, - strand Genetic Position: Chr14, 36.32 cM, cytoband D1
• Alliance: Polr3d^em1(IMPC)Tcp page
• IMPC: Polr3d gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1163 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTAAGTACACTACGAGAAT targeting the 5' side and AGAAGGATGACGTAGGTGCC targeting the 3' side of a critical region.This resulted in a 539-bp deletion from Chr14: 70441033 to 70441571 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr3d Mutation: 15 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)