Hk3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hk3^em1(IMPC)Tcp
• Name: hexokinase 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257703
• Gene: Hk3 Location: Chr13:55153798-55169198 bp, - strand Genetic Position: Chr13, 29.8 cM
• Alliance: Hk3^em1(IMPC)Tcp page
• IMPC: Hk3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1106 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGAGTACTGGTTAGAATCT and CCACATCAATCCTGTAGGTC targeting the 5' side and AGGCCTCAGTGTAACCGGGC and CTCGGGGTTCTAGCACGCTG targeting the 3' side of a critical exon. This resulted in a 686-bp del Chr13: 55012899 to 55013584, 12-bp del Chr13: 55013738 to 55013749 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hk3 Mutation: 45 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)