Hps6^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hps6^em1(IMPC)Tcp
• Name: HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257719
• Gene: Hps6 Location: Chr19:45991947-45994612 bp, + strand Genetic Position: Chr19, 38.75 cM
• Alliance: Hps6^em1(IMPC)Tcp page
• IMPC: Hps6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1137 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTCCGCGAGTTGTTGGCGG, AAAAGACGTCCAGCGGCGAG and GGGTCCACGAGGTGGTGTAG targeting a critical exon. This resulted in a 36-bp deletion Chr19:46003690 to 46003725 and 2,084-bp del Chr19:46003853 to 46005936 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hps6 Mutation: 28 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)