Myo6^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myo6^em1(IMPC)Tcp
• Name: myosin VI; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257724
• Gene: Myo6 Location: Chr9:80072313-80219011 bp, + strand Genetic Position: Chr9, 43.98 cM
• Alliance: Myo6^em1(IMPC)Tcp page
• IMPC: Myo6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0947 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTTGATTCTCGTACAAAC and TTGGCCACATATGTCTAAGT targeting the 5' side and CCACCCCATGTCTTTGCCAT and TAAGGATGCTTTCATGCAAG targeting the 3' side of a critical exon. This resulted in a 128-bp del Chr9: 80228855 to 80228982 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myo6 Mutation: 91 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)