Naaladl2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naaladl2^em1(IMPC)Tcp
• Name: N-acetylated alpha-linked acidic dipeptidase-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257753
• Gene: Naaladl2 Location: Chr3:23852267-25198425 bp, - strand Genetic Position: Chr3, 9.24 cM
• Alliance: Naaladl2^em1(IMPC)Tcp page
• IMPC: Naaladl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1135 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTTTGGAACTGATTGTATA and GAGTCATACTAAATCAAAGC targeting the 5' side and ATATTCCGTGTAGCAATGCC targeting the 3' side of a critical exon. This resulted in a 712-bp del Chr3:24432799 to 24433510 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Naaladl2 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)