Dnah2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnah2^em1(IMPC)Tcp
• Name: dynein, axonemal, heavy chain 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257800
• Synonyms: Dnah2^delta
• Gene: Dnah2 Location: Chr11:69311635-69439934 bp, - strand Genetic Position: Chr11, 42.63 cM, cytoband B4
• Alliance: Dnah2^em1(IMPC)Tcp page
• IMPC: Dnah2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1073 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGTCACACTAACCACCCCA and TGTTCTGGGCCGCAGGCACT targeting the 5' side and CAAATGCGTATAACCAGCGA and ATCACTACTCACGGTCACAA targeting the 3' side of a critical exon. This resulted in a 1295-bp deletion of Chr11 from 69483130 to 69484424 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnah2 Mutation: 228 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)