Prpf8^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf8^em1(IMPC)Bay
• Name: pre-mRNA processing factor 8; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257811
• Gene: Prpf8 Location: Chr11:75377642-75400275 bp, + strand Genetic Position: Chr11, 45.92 cM
• Alliance: Prpf8^em1(IMPC)Bay page
• IMPC: Prpf8 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CTTAGCCTCTGCCTACATACTGG, CCTCCTTTCTTGAGCTCAGGAGT, GAAGTTGCTTTCAAAGGGACGGG, GGGTGTTAGTTTCTACAGACTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prpf8 Mutation: 88 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)