Slco6d1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slco6d1^em1(IMPC)Tcp
• Name: solute carrier organic anion transporter family, member 6d1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257823
• Gene: Slco6d1 Location: Chr1:98348849-98444716 bp, + strand Genetic Position: Chr1, 47.76 cM, cytoband D
• Alliance: Slco6d1^em1(IMPC)Tcp page
• IMPC: Slco6d1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1120 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATTTGTGTGGCAATACCGT targeting the 5' side and CACGTTCCCACAAACTCATC targeting the 3' side of a critical exon. This resulted in a 125-bp del Chr1:98428310 to 98428434 c.598_722del; p.V200Ifs*27.(GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slco6d1 Mutation: 48 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)