Tmem8b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem8b^em1(IMPC)Tcp
• Name: transmembrane protein 8B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257826
• Gene: Tmem8b Location: Chr4:43668971-43692668 bp, + strand Genetic Position: Chr4, 23.05 cM
• Alliance: Tmem8b^em1(IMPC)Tcp page
• IMPC: Tmem8b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1136 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) having spacer sequences of GGAACCAGGTCCCCGTCTGT and AGTGCCGACGCGCTCACCTA targeting a critical exon. This resulted in a 457-bp del Chr4:43685599 to 43686055 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem8b Mutation: 43 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)