Kansl3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kansl3^em1(IMPC)J
• Name: KAT8 regulatory NSL complex subunit 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258443
• Synonyms: Kansl3^-
• Gene: Kansl3 Location: Chr1:36374811-36408262 bp, - strand Genetic Position: Chr1, 15.22 cM
• Alliance: Kansl3^em1(IMPC)J page
• IMPC: Kansl3 gene page

Kansl3^em1(IMPC)J/Kansl3^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida and are dead after 72 hours in vitro, never forming outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTGTGGTGGAAGAGACG and CCGCAAGTCACAACAAATCA, which resulted in an 898 bp deletion beginning at Chromosome 1 position 36,357,760 bp and ending after 36,358,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000156007, ENSMUSE00000155996 (exons 4 and 5) and 621 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	10 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kansl3 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)