Mphosph10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mphosph10^em1(IMPC)J
• Name: M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258450
• Gene: Mphosph10 Location: Chr7:64026289-64041984 bp, - strand Genetic Position: Chr7, 34.64 cM, cytoband C
• Alliance: Mphosph10^em1(IMPC)J page
• IMPC: Mphosph10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTCCTTATGGTTTTATGG and CTACTTGCCTGGAGATACCC, which resulted in a 1188 bp deletion beginning at Chromosome 7 position 64,389,174 bp and ending after 64,390,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000592989 (exon 2) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mphosph10 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)