About   Help   FAQ
Plekhj1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Plekhj1em1(IMPC)J
Name: pleckstrin homology domain containing, family J member 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258452
Gene: Plekhj1  Location: Chr10:80631933-80634404 bp, - strand  Genetic Position: Chr10, 39.72 cM, cytoband C1
Alliance: Plekhj1em1(IMPC)J page
IMPC: Plekhj1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCACTCCCCAAAACCCA and AATCCTGGTGAGAGGAAGCT, which resulted in a 1061 bp deletion beginning at Chromosome 10 position 80,795,850 bp and ending after 80,796,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000306173, ENSMUSE00000306166 and ENSMUSE00001413139 (exons 4-6) and 469 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 48 amino acids later probably by read through after exon 3. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Plekhj1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory